popularkon popularkon

03-10-2018
Mathematics

contestada

PLEASE HELP! 25 POINTS!!!!!

list the question number then answer

PLEASE HELP 25 POINTS list the question number then answer class=

PLEASE HELP 25 POINTS list the question number then answer class=

PLEASE HELP 25 POINTS list the question number then answer class=

PLEASE HELP 25 POINTS list the question number then answer class=

PLEASE HELP 25 POINTS list the question number then answer class=

Respuesta :

kgk12604 kgk12604

03-10-2018

6. The answer is A. 3 - 3x

7. The answer is C. -30

8. The answer is B. -11

9. Believe the answer is B. 7xy

10. The answer is A. 48

Answer Link

Brainiac467 Brainiac467

03-10-2018

6. 3 - 3x
7. -30
8. -11
9. 7xy
10. 48

Answer Link

Otras preguntas

Hi i need some help on question 11 b and c. I have already done a

234Weight (pounds)OA. The weight of the package is a function of the number ofpackages.B. The shipping cost is a function of the number of packages.C. The shipp

The mass number of an atom is found by1) adding the number of protons and neutrons.2) adding the number of protons and electrons.3) subtracting the number of pr

c-884= -853solve for c

Of the books in a personal library, 2/5 are fiction. Of these books, 3/5 are paperback. What fraction of the books in the library are fiction and paperbacks?

someone please help and please answer quickly my brainly keeps crashing

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Consider functions f and g.1 + 12f(1) = 12 + 4. – 12for * # 2 and 7 -64.2 – 16. + 1641 +48for a # -12 Which expression is equal to f(x) · g(t)?OA.41 - 81 + 61OB

21 The number of students in each of 2 exercise classes was the same. The box and whiskerplots below represent the average amount of time the students in each c

What is the difference between a rectangle and a rhombus?