sandrarbuckler069 sandrarbuckler069

01-03-2022
English

contestada

What is the punctuation for I believe there are three factors that lead to success pursuing your passion working hard never giving up remaining positive and collaborating well with others

Respuesta :

01-03-2022

Answer:

I believe there are three factors that lead to success, pursuing your passion, working hard, never giving up, remaining positive, and collaborating well with others.

P.S. You put 5 factors that lead to success but I'll leave it the way it is.

Answer Link

Otras preguntas

Satellite can focus on specific latitudes using?

Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.

In the adult, the internal reproductive organs and the urinary bladder are "housed" in which body cavity?

Why did some americans feel that the united states should help europe after world war ii?

Social ___ is a large category of people who share many similar levels of wealth , power, and prestige

the height h in feet of a projectile launched upward at a speed of 32 feet/ second from a height of 48 feet is given by the function : h(t) =16^2+32t +48. how l

BC is parallel to DE What is AC? Enter your answer in the box.

1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m

The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat