Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Question

01-06-2022
Biology

contestada

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Respuesta :

Otras preguntas

A 10-year-old client with asthma is prescribed 2 mg of albuterol syrup four times per day. the syrup is available as a formulation of 2 mg/5 ml. how many millil

The function p(s)=−10s2+110s−180 represents a company's profit p made on selling a product for s dollars per unit. Calculate and interpret p(6). (1 point) 1. If

which author had the most titles on a single new york times best-seller list in 2022?

which best-selling book, written by angela duckworth, explains how success can be achieved by a combination of passion and persistence?

What is 1984 about? Should I read it?

What type of element is SBR4

A student wants to make a model to explain how a lunar eclipse happens. Which model shows the positions of Earth, the sun, and the moon during a lunar eclipse?

The solubility of o2 in water is 6.5mg/l at an atmospheric pressure of 1.0 atm and temperature of 40.0 c. calculate henrys law constant of o2 at 40c. the molar

6 cups of water is 2/3 of a jug find the total number of cups of water in the jug

The longest dreams occur just as we are falling asleep. truefalse

luisvaschetto luisvaschetto · Answer 1 · 2022-06-07T13:27:31+02:00

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1