Project: Solve the Case
You have learned that DNA testing can be used to solve crimes. One of the most common methods used to analyze DNA base pair sequences is called the Southern Blot, named after its inventor, British biologist Edwin Southern. Once the DNA sample is isolated from the cell, it is cut using special enzymes and sorted by size. The DNA is heated or chemically treated until it splits into a single strand. The strand is bonded to a special piece of nitrocellulose paper and exposed to a radioactive genetic probe. The probe is a specific sequence of 100 to 1,000 DNA bases. If an X-ray is taken of the paper after exposure to the probe, only areas where the probe attaches to the sample will show up on the film. For example, a probe sequence of ATTAG would attach to a corresponding TAATC sequence on the DNA sample.
Part One
Read the following case summary.
Case #28104
Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.
Part Two
Copy the DNA sequences for each suspect into a Word document.
Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)
Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).
Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.
Repeat step 1 with the DNA samples for Suspects B and C.
Suspect A
TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA
Suspect B
TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA
Suspect C
TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA
Probe
AGGT
Questions
Answer these following questions in the essay box below.
Which suspect most likely committed the robbery?
How do you know?
